b1600 Gene Page

Solution location in genomic coordinates: 1671734-1671757 R
Solution sequence with flanking nucleotides: gaagc AACACTGCGGATAATTGTAATATT atgga
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 18.68
Model logo: b1600.2.model.LGO.gif
Sequence logo: b1600.2.LGO.gif
Sequence Alignment: b1600.2.ALGN
Solution location in genomic coordinates: 1671650-1671673 R
Solution sequence with flanking nucleotides: ccact ATCTTGCTCGTAGGTGAGCAGCAC tggcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1671527-1671550 R
Solution sequence with flanking nucleotides: ttaaa ATAATTCTCTTGCAGGAGAAGGAC a
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ydgF_ydgG_IR     Overlap: 4

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 17.58
Model logo: b1600.3.model.LGO.gif
Sequence logo: b1600.3.LGO.gif
Sequence Alignment: b1600.3.ALGN
Solution location in genomic coordinates: 1671774-1671789 R
Solution sequence with flanking nucleotides: ctacc GAGGACAATTATCATC cgcga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1671736-1671751 R
Solution sequence with flanking nucleotides: acact GCGGATAATTGTAATA ttatg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page