b1605 Gene Page

Genbank name: b1605
EcoGene name: ydgI
Divergent gene:
Species with an ortholog: EC PA ST VC YP
EcoGene link: EG13930

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.74
Model logo: b1605.1.model.LGO.gif
Sequence logo: b1605.1.LGO.gif
Sequence Alignment: b1605.1.ALGN
Solution location in genomic coordinates: 1677521-1677544
Solution sequence with flanking nucleotides: ctcca TTTTTATGCGTTTTGCCCTAATAT ttatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.78
Model logo: b1605.2.model.LGO.gif
Sequence logo: b1605.2.LGO.gif
Sequence Alignment: b1605.2.ALGN
Solution location in genomic coordinates: 1677486-1677502
Solution sequence with flanking nucleotides: catct CTTCGTAAAATCCCGCG cttca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC VC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.42
Model logo: b1605.3.model.LGO.gif
Sequence logo: b1605.3.LGO.gif
Sequence Alignment: b1605.3.ALGN
Solution location in genomic coordinates: 1677561-1677577
Solution sequence with flanking nucleotides: atcac GTTTTAATCACTGGATA tcg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page