b1624 Gene Page

Genbank name: b1624
EcoGene name: ydgJ
Divergent gene: ydgT
Species with an ortholog: EC   PA   ST   VC   YP   
EcoGene link: EG13931

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 5.00
Model logo: b1624.1.model.LGO.gif
Sequence logo: b1624.1.LGO.gif
Sequence Alignment: b1624.1.ALGN
Solution location in genomic coordinates: 1702767-1702787 R
Solution sequence with flanking nucleotides: acatc GAACAAGATAATAAATTCCTG gttta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1702389-1702409 R
Solution sequence with flanking nucleotides: attgc TGGCAGGTTATTAAACTGTTG agcgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 4.15
Model logo: b1624.2.model.LGO.gif
Sequence logo: b1624.2.LGO.gif
Sequence Alignment: b1624.2.ALGN
Solution location in genomic coordinates: 1702766-1702788 R
Solution sequence with flanking nucleotides: aacat CGAACAAGATAATAAATTCCTGG tttaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1702577-1702599 R
Solution sequence with flanking nucleotides: ccaac CTGTTAATTCAATAAGACGATTC attac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 3.69
Model logo: b1624.3.model.LGO.gif
Sequence logo: b1624.3.LGO.gif
Sequence Alignment: b1624.3.ALGN
Solution location in genomic coordinates: 1702850-1702868 R
Solution sequence with flanking nucleotides: cgc TGATGGCAAATATTCAGGG atgaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1702793-1702811 R
Solution sequence with flanking nucleotides: tacta TCCCTGACAATCACCAACA acatc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page