b1627 Gene Page

Genbank name: b1627
EcoGene name: ydgL
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST VC YP
EcoGene link: EG13933

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 29.43
Model logo: b1627.1.model.LGO.gif
Sequence logo: b1627.1.LGO.gif
Sequence Alignment: b1627.1.ALGN
Solution location in genomic coordinates: 1703756-1703777
Solution sequence with flanking nucleotides: ttaac GGATAATAGGCGGCTTTTTTAT ttcag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 15.50
Model logo: b1627.2.model.LGO.gif
Sequence logo: b1627.2.LGO.gif
Sequence Alignment: b1627.2.ALGN
Solution location in genomic coordinates: 1703719-1703737
Solution sequence with flanking nucleotides: ataac CTTACAGTTAACCTGTTGT cgcct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 1.14
Model logo: b1627.3.model.LGO.gif
Sequence logo: b1627.3.LGO.gif
Sequence Alignment: b1627.3.ALGN
Solution location in genomic coordinates: 1703738-1703755
Solution sequence with flanking nucleotides: gttgt CGCCTGCTCTGGATTAAC ggata
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page