b1647 Gene Page
Genbank name: b1647
EcoGene name: ydhF
Divergent gene:
Species with an ortholog:
EC ST VC YP
EcoGene link: EG13420
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.05
Model logo: b1647.1.model.LGO.gif
Sequence logo: b1647.1.LGO.gif
Sequence Alignment: b1647.1.ALGN
Solution location in genomic coordinates: 1723682-1723697 R
Solution sequence with flanking nucleotides: ctaat CTTGCGTATACTCCTC tcata
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.21
Model logo: b1647.2.model.LGO.gif
Sequence logo: b1647.2.LGO.gif
Sequence Alignment: b1647.2.ALGN
Solution location in genomic coordinates: 1723657-1723677 R
Solution sequence with flanking nucleotides: ctcat ATCTGATAAGAGGAAGCGATT
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page