b1648 Gene Page
Genbank name: b1648
EcoGene name: ydhL
Divergent gene: ydhM
Species with an ortholog:
EC ST
EcoGene link: EG13946
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 13.14
Model logo: b1648.1.model.LGO.gif
Sequence logo: b1648.1.LGO.gif
Sequence Alignment: b1648.1.ALGN
Solution location in genomic coordinates: 1724187-1724206 R
Solution sequence with flanking nucleotides: aaacg CTTCTTTAGAGCGAAAGTAG tgata
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.40
Model logo: b1648.2.model.LGO.gif
Sequence logo: b1648.2.LGO.gif
Sequence Alignment: b1648.2.ALGN
Solution location in genomic coordinates: 1724101-1724120 R
Solution sequence with flanking nucleotides: tgaat CCACGTTGCAGGCAAAGTTG ctcgc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 9.07
Model logo: b1648.3.model.LGO.gif
Sequence logo: b1648.3.LGO.gif
Sequence Alignment: b1648.3.ALGN
Solution location in genomic coordinates: 1724260-1724280 R
Solution sequence with flanking nucleotides: ccttc GCCGGATTGCAGCAACTCAGT cagtc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1724140-1724160 R
Solution sequence with flanking nucleotides: acttc AGCGGTTTTTAGTAATTCGCT tagcc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page