b1649 Gene Page
Genbank name: b1649
EcoGene name: ydhM
Divergent gene: ydhL
Species with an ortholog:
EC PA SP ST YP
EcoGene link: EG13947
Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 23.16
Model logo: b1649.1.model.LGO.gif
Sequence logo: b1649.1.LGO.gif
Sequence Alignment: b1649.1.ALGN
Solution location in genomic coordinates: 1724017-1724032
Solution sequence with flanking nucleotides: tgcac TAGACCGACTGGTCTA ctaca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 10.02
Model logo: b1649.2.model.LGO.gif
Sequence logo: b1649.2.LGO.gif
Sequence Alignment: b1649.2.ALGN
Solution location in genomic coordinates: 1723607-1723627
Solution sequence with flanking nucleotides: tcaca AAACGGGAAAACTCCGGGCCT tgcgg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1723885-1723905
Solution sequence with flanking nucleotides: tcgtc AGACTGGCAAATTCCCCGGCA cgggc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 8.47
Model logo: b1649.3.model.LGO.gif
Sequence logo: b1649.3.LGO.gif
Sequence Alignment: b1649.3.ALGN
Solution location in genomic coordinates: 1723982-1724005
Solution sequence with flanking nucleotides: ttgaa GCTGTTAATGTCCAAAGTAGCAAC tttgc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page