b1657 Gene Page

Genbank name: b1657
EcoGene name: ydhP
Divergent gene: purR
Species with an ortholog: EC PA ST YP
EcoGene link: EG13950

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 2.55
Model logo: b1657.1.model.LGO.gif
Sequence logo: b1657.1.LGO.gif
Sequence Alignment: b1657.1.ALGN
Solution location in genomic coordinates: 1735678-1735698 R
Solution sequence with flanking nucleotides: ttttg GCCGATCTTGACGAAAAGGGG aagtg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 1.75
Model logo: b1657.2.model.LGO.gif
Sequence logo: b1657.2.LGO.gif
Sequence Alignment: b1657.2.ALGN
Solution location in genomic coordinates: 1735344-1735360 R
Solution sequence with flanking nucleotides: tcgcc ACTTTAATGAATATCGC gtaat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.53
Model logo: b1657.3.model.LGO.gif
Sequence logo: b1657.3.LGO.gif
Sequence Alignment: b1657.3.ALGN
Solution location in genomic coordinates: 1735479-1735500 R
Solution sequence with flanking nucleotides: tgggt TTGACTGCCGCGCTGCACTGAT ttcct
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page