b1688 Gene Page

Genbank name: b1688
EcoGene name: ydiK
Divergent gene: ydiJ
Species with an ortholog: EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG13970

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 18.67
Model logo: b1688.1.model.LGO.gif
Sequence logo: b1688.1.LGO.gif
Sequence Alignment: b1688.1.ALGN
Solution location in genomic coordinates: 1766982-1767004
Solution sequence with flanking nucleotides: cagaa TTAAGGGCAGAATCGGCCTGTTA aaaac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1767005-1767027
Solution sequence with flanking nucleotides: tgtta AAAACCGCTGAAATTGCTCATCA ttatg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 6.59
Model logo: b1688.2.model.LGO.gif
Sequence logo: b1688.2.LGO.gif
Sequence Alignment: b1688.2.ALGN
Solution location in genomic coordinates: 1766817-1766839
Solution sequence with flanking nucleotides: ttcgt GTTGCAGGAAGGCGGCAAGCGAG tgaac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU10     Overlap: 23

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.82
Model logo: b1688.3.model.LGO.gif
Sequence logo: b1688.3.LGO.gif
Sequence Alignment: b1688.3.ALGN
Solution location in genomic coordinates: 1767055-1767078
Solution sequence with flanking nucleotides: ttcac GTCGCGTCGACGATTTGACGCACA aaaaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page