b1706 Gene Page

Genbank name: b1706
EcoGene name: ydiU
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG13980

Species that contributed to the solution: EC SP ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 10.09
Model logo: b1706.1.model.LGO.gif
Sequence logo: b1706.1.LGO.gif
Sequence Alignment: b1706.1.ALGN
Solution location in genomic coordinates: 1789311-1789333 R
Solution sequence with flanking nucleotides: TAACCCTTCTGTTTGCTGGTGTT taaga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ydiU_ydiV_IR Overlap: 20
Solution location in genomic coordinates: 1789269-1789291 R
Solution sequence with flanking nucleotides: ccgtc TACACTATCAAACAGGAGGATCT
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ydiU_ydiV_IR Overlap: 19

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.18
Model logo: b1706.2.model.LGO.gif
Sequence logo: b1706.2.LGO.gif
Sequence Alignment: b1706.2.ALGN
Solution location in genomic coordinates: 1789292-1789309 R
Solution sequence with flanking nucleotides: tgttt AAGACGAGAGTAACCGTC tacac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ydiU_ydiV_IR Overlap: 18

Gene Index Page