b1724 Gene Page

Genbank name: b1724
EcoGene name: ydiZ
Divergent gene:
Species with an ortholog: EC ST
EcoGene link: EG13985

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.74
Model logo: b1724.1.model.LGO.gif
Sequence logo: b1724.1.LGO.gif
Sequence Alignment: b1724.1.ALGN
Solution location in genomic coordinates: 1805331-1805352
Solution sequence with flanking nucleotides: aaaac ATTCCCCCAGCATTGGGGGAAT catca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: pfkB_ydiZ_IR Overlap: 22

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 4.24
Model logo: b1724.2.model.LGO.gif
Sequence logo: b1724.2.LGO.gif
Sequence Alignment: b1724.2.ALGN
Solution location in genomic coordinates: 1805356-1805379
Solution sequence with flanking nucleotides: atcat CACCAACCTGTCGGCAACGCGTTT ctccg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1805396-1805419
Solution sequence with flanking nucleotides: ctcaa AAGTCATGTGATAACAAAGGGGTG aact
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page