b1725 Gene Page

Genbank name: b1725
EcoGene name: yniA
Divergent gene:
Species with an ortholog: AA EC ST VC YP
EcoGene link: EG13986

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 11.31
Model logo: b1725.1.model.LGO.gif
Sequence logo: b1725.1.LGO.gif
Sequence Alignment: b1725.1.ALGN
Solution location in genomic coordinates: 1805744-1805759
Solution sequence with flanking nucleotides: tgtgg TGTGCGTTAGCTCGTG ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1805788-1805803
Solution sequence with flanking nucleotides: aacct TATGATCTGGCAGACA acatg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 10.81
Model logo: b1725.2.model.LGO.gif
Sequence logo: b1725.2.LGO.gif
Sequence Alignment: b1725.2.ALGN
Solution location in genomic coordinates: 1805762-1805784
Solution sequence with flanking nucleotides: gtgtt TTTACACCGCATTCTTGCGCTAA cctta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 8.25
Model logo: b1725.3.model.LGO.gif
Sequence logo: b1725.3.LGO.gif
Sequence Alignment: b1725.3.ALGN
Solution location in genomic coordinates: 1805716-1805735
Solution sequence with flanking nucleotides: taaa TGGTTTTTGGGCAATAATCA gtctg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page