b1729 Gene Page
Genbank name: b1729
EcoGene name: ydjN
Divergent gene:
Species with an ortholog:
EC HI SP ST VC YP
EcoGene link: EG13990
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 21.51
Model logo: b1729.1.model.LGO.gif
Sequence logo: b1729.1.LGO.gif
Sequence Alignment: b1729.1.ALGN
Solution location in genomic coordinates: 1808849-1808872
Solution sequence with flanking nucleotides: tctgg AATAAGCAATTCCATTTGAATATA agagc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 12.43
Model logo: b1729.2.model.LGO.gif
Sequence logo: b1729.2.LGO.gif
Sequence Alignment: b1729.2.ALGN
Solution location in genomic coordinates: 1808886-1808909
Solution sequence with flanking nucleotides: ctcac AGTTCTGTTAATCTTGCGCCAACA ctatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 9.73
Model logo: b1729.3.model.LGO.gif
Sequence logo: b1729.3.LGO.gif
Sequence Alignment: b1729.3.ALGN
Solution location in genomic coordinates: 1808886-1808909
Solution sequence with flanking nucleotides: ctcac AGTTCTGTTAATCTTGCGCCAACA ctatg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1808917-1808940
Solution sequence with flanking nucleotides: atgac TGCTACGCAGTGATAGAAATAATA agatc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page