b1741 Gene Page

Genbank name: b1741
EcoGene name: ydjQ
Divergent gene:
Species with an ortholog: EC ST
EcoGene link: EG13993 Reported site,genomic coordinates and site type: DPInteract 1821506:1821525 lexA

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.70
Model logo: b1741.1.model.LGO.gif
Sequence logo: b1741.1.LGO.gif
Sequence Alignment: b1741.1.ALGN
Solution location in genomic coordinates: 1821507-1821524
Solution sequence with flanking nucleotides: gttac ACTGGATAGATAACCAGC attcg
Number of overlapping basepairs with reported site: 18
Site type: lexA

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 2.65
Model logo: b1741.2.model.LGO.gif
Sequence logo:
Sequence Alignment: b1741.2.ALGN
Solution location in genomic coordinates: 1821313-1821336
Solution sequence with flanking nucleotides: aataa TTTGCACATATTGGATTGTGCGAA aaaga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1821425-1821441
Solution sequence with flanking nucleotides: tcgaa TAGGCCTGACAGGCGTA gcacg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPv130b Overlap: 17

Gene Index Page