b1770 Gene Page

Genbank name: b1770
EcoGene name: ydjF
Divergent gene:
Species with an ortholog: EC   HI   ST   VC   
EcoGene link: EG13482

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 5.39
Model logo: b1770.1.model.LGO.gif
Sequence logo: b1770.1.LGO.gif
Sequence Alignment: b1770.1.ALGN
Solution location in genomic coordinates: 1852980-1853000 R
Solution sequence with flanking nucleotides: acgat TCACCTCTGTTTCTGTGAAAA ctgtg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1852918-1852938 R
Solution sequence with flanking nucleotides: gaaag TAAACATCGGTTATGCGATAA tcgcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.02
Model logo: b1770.2.model.LGO.gif
Sequence logo: b1770.2.LGO.gif
Sequence Alignment: b1770.2.ALGN
Solution location in genomic coordinates: 1852954-1852975 R
Solution sequence with flanking nucleotides: actgt GATGAAAATCTGTGATTCAAAC aggtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 1.29
Model logo: b1770.3.model.LGO.gif
Sequence logo: b1770.3.LGO.gif
Sequence Alignment: b1770.3.ALGN
Solution location in genomic coordinates: 1852890-1852912 R
Solution sequence with flanking nucleotides: tcgcg CTAATGTGATGTAAAAAGATACA ggggt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page