b1781 Gene Page

Genbank name: b1781
EcoGene name: yeaE
Divergent gene:
Species with an ortholog: EC PA ST YP
EcoGene link: EG13491

Species that contributed to the solution: EC PA
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.66
Model logo: b1781.1.model.LGO.gif
Sequence logo: b1781.1.LGO.gif
Sequence Alignment: b1781.1.ALGN
Solution location in genomic coordinates: 1863697-1863715 R
Solution sequence with flanking nucleotides: taaaa ACAGGGCGTCACGCCCTGT tttgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yeaE_mipA_IR Overlap: 19

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 1.98
Model logo: b1781.2.model.LGO.gif
Sequence logo: b1781.2.LGO.gif
Sequence Alignment: b1781.2.ALGN
Solution location in genomic coordinates: 1863678-1863694 R
Solution sequence with flanking nucleotides: tgttt TGCATTACGGTGGTGCA atacc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yeaE_mipA_IR Overlap: 1

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 1.69
Model logo: b1781.3.model.LGO.gif
Sequence logo: b1781.3.LGO.gif
Sequence Alignment: b1781.3.ALGN
Solution location in genomic coordinates: 1863725-1863744 R
Solution sequence with flanking nucleotides: taatg CATCTTTCCAGGGCATTTTG tgcat
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page