b1808 Gene Page

Genbank name: b1808
EcoGene name: yoaA
Divergent gene: yoaB
Species with an ortholog: EC HI PA SP ST TF VC YP
EcoGene link: EG13513

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.00
Model logo: b1808.1.model.LGO.gif
Sequence logo: b1808.1.LGO.gif
Sequence Alignment: b1808.1.ALGN
Solution location in genomic coordinates: 1891266-1891285 R
Solution sequence with flanking nucleotides: ataat CCCTGTTCAAATCAACAGGG ggtag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 8.98
Model logo: b1808.2.model.LGO.gif
Sequence logo: b1808.2.LGO.gif
Sequence Alignment: b1808.2.ALGN
Solution location in genomic coordinates: 1891306-1891329 R
Solution sequence with flanking nucleotides: gtcgc CGTCACCACTTCAACTGGCGAAAG cgccc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 8.56
Model logo: b1808.3.model.LGO.gif
Sequence logo: b1808.3.LGO.gif
Sequence Alignment: b1808.3.ALGN
Solution location in genomic coordinates: 1891311-1891330 R
Solution sequence with flanking nucleotides: ggtcg CCGTCACCACTTCAACTGGC gaaag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1891266-1891285 R
Solution sequence with flanking nucleotides: ataat CCCTGTTCAAATCAACAGGG ggtag
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page