b1809 Gene Page

Genbank name: b1809
EcoGene name: yoaB
Divergent gene: yoaA
Species with an ortholog: AA   EC   HI   SP   ST   YP   
EcoGene link: EG13514

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 18.47
Model logo: b1809.1.model.LGO.gif
Sequence logo: b1809.1.LGO.gif
Sequence Alignment: b1809.1.ALGN
Solution location in genomic coordinates: 1891261-1891283
Solution sequence with flanking nucleotides: a CTACCCCCTGTTGATTTGAACAG ggatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1891306-1891328
Solution sequence with flanking nucleotides: gggcg CTTTCGCCAGTTGAAGTGGTGAC ggcga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 8.46
Model logo: b1809.2.model.LGO.gif
Sequence logo: b1809.2.LGO.gif
Sequence Alignment: b1809.2.ALGN
Solution location in genomic coordinates: 1891285-1891304
Solution sequence with flanking nucleotides: acagg GATTATGTCAGGATGAGGGC gcttt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page