b1815 Gene Page

Genbank name: b1815
EcoGene name: yoaD
Divergent gene:
Species with an ortholog: EC PA ST
EcoGene link: EG13516

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 14.52
Model logo: b1815.1.model.LGO.gif
Sequence logo: b1815.1.LGO.gif
Sequence Alignment: b1815.1.ALGN
Solution location in genomic coordinates: 1896332-1896354
Solution sequence with flanking nucleotides: ttact CGCCCATCTGCAACGGATGGGCG aattt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: sdaA_yoaD_IR Overlap: 23

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.71
Model logo: b1815.2.model.LGO.gif
Sequence logo: b1815.2.LGO.gif
Sequence Alignment: b1815.2.ALGN
Solution location in genomic coordinates: 1896392-1896412
Solution sequence with flanking nucleotides: ttccc CACTACACTTCCACTGTTGCG tcagg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page