b1821 Gene Page

Solution location in genomic coordinates: 1903330-1903349
Solution sequence with flanking nucleotides: aatca GACATAGCTTAGGCTATATT acctc
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 22.57
Model logo: b1821.2.model.LGO.gif
Sequence logo: b1821.2.LGO.gif
Sequence Alignment: b1821.2.ALGN
Solution location in genomic coordinates: 1903403-1903421
Solution sequence with flanking nucleotides: atcca AATGAAAATCGTTATCAAT aaagc
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 17.73
Model logo: b1821.3.model.LGO.gif
Sequence logo: b1821.3.LGO.gif
Sequence Alignment: b1821.3.ALGN
Solution location in genomic coordinates: 1903451-1903469
Solution sequence with flanking nucleotides: acagt TGTTTTATATTCTCAAAAT atgtt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1903505-1903523
Solution sequence with flanking nucleotides: agccg ATTTCCAGATTCCGGAAAT gtacg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page