b1832 Gene Page

Genbank name: b1832
EcoGene name: yebR
Divergent gene: yebS
Species with an ortholog: EC ST VC YP
EcoGene link: EG14020

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 11.43
Model logo: b1832.1.model.LGO.gif
Sequence logo: b1832.1.LGO.gif
Sequence Alignment: b1832.1.ALGN
Solution location in genomic coordinates: 1914249-1914272 R
Solution sequence with flanking nucleotides: tgcca AATGTAATAAGAATTAACATTAAT cttaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1914209-1914232 R
Solution sequence with flanking nucleotides: atggg AATGATCTTGAGCATTAACGCATT ta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.74
Model logo: b1832.2.model.LGO.gif
Sequence logo: b1832.2.LGO.gif
Sequence Alignment: b1832.2.ALGN
Solution location in genomic coordinates: 1914233-1914248 R
Solution sequence with flanking nucleotides: ttaat CTTAACCCATGATGGG aatga
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page