b1833 Gene Page
Genbank name: b1833
EcoGene name: yebS
Divergent gene: yebR
Species with an ortholog:
EC PA ST YP
EcoGene link: EG14021
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 10.76
Model logo: b1833.1.model.LGO.gif
Sequence logo: b1833.1.LGO.gif
Sequence Alignment: b1833.1.ALGN
Solution location in genomic coordinates: 1914209-1914232
Solution sequence with flanking nucleotides: ta AATGCGTTAATGCTCAAGATCATT cccat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 7.25
Model logo: b1833.2.model.LGO.gif
Sequence logo: b1833.2.LGO.gif
Sequence Alignment: b1833.2.ALGN
Solution location in genomic coordinates: 1914216-1914239
Solution sequence with flanking nucleotides: tgcgt TAATGCTCAAGATCATTCCCATCA tgggt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1914245-1914268
Solution sequence with flanking nucleotides: tgggt TAAGATTAATGTTAATTCTTATTA cattt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 4.31
Model logo: b1833.3.model.LGO.gif
Sequence logo: b1833.3.LGO.gif
Sequence Alignment: b1833.3.ALGN
Solution location in genomic coordinates: 1914234-1914252
Solution sequence with flanking nucleotides: cattc CCATCATGGGTTAAGATTA atgtt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page