b1971 Gene Page

Genbank name: b1971
EcoGene name: yedY
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   YP   
EcoGene link: EG14047

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 3.70
Model logo: b1971.1.model.LGO.gif
Sequence logo:
Sequence Alignment: b1971.1.ALGN
Solution location in genomic coordinates: 2037425-2037446
Solution sequence with flanking nucleotides: ctact GTTAGGGAGGACACTCCCTGAC agatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 1.74
Model logo: b1971.2.model.LGO.gif
Sequence logo: b1971.2.LGO.gif
Sequence Alignment: b1971.2.ALGN
Solution location in genomic coordinates: 2037402-2037424
Solution sequence with flanking nucleotides: aaata TGTAAAAGCAGATCTCTGCTACT gttag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2037449-2037471
Solution sequence with flanking nucleotides: gacag ATTAACAGTAAACGGCTCTTGCT ggcta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: -0.71
Model logo: b1971.3.model.LGO.gif
Sequence logo: b1971.3.LGO.gif
Sequence Alignment: b1971.3.ALGN
Solution location in genomic coordinates: 2037477-2037498
Solution sequence with flanking nucleotides: ggcta ACGACAAAAAAGTGTGATGGCT t
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page