b1983 Gene Page

Genbank name: b1983
EcoGene name: yeeN
Divergent gene:
Species with an ortholog: AA EC HI SP ST TF VC
EcoGene link: EG13382

Species that contributed to the solution: AA EC HI SP ST TF
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 16.37
Model logo: b1983.1.model.LGO.gif
Sequence logo: b1983.1.LGO.gif
Sequence Alignment: b1983.1.ALGN
Solution location in genomic coordinates: 2054743-2054762
Solution sequence with flanking nucleotides: taaaa TTAAATATAAGATTATGGCT ttaga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 12.93
Model logo: b1983.2.model.LGO.gif
Sequence logo: b1983.2.LGO.gif
Sequence Alignment: b1983.2.ALGN
Solution location in genomic coordinates: 2054802-2054822
Solution sequence with flanking nucleotides: tcctg TTATGATATAATATGCTGAAT taaca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST TF VC
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 12.24
Model logo: b1983.3.model.LGO.gif
Sequence logo: b1983.3.LGO.gif
Sequence Alignment: b1983.3.ALGN
Solution location in genomic coordinates: 2054692-2054711
Solution sequence with flanking nucleotides: atgct TTCAAAACACAATTATAAAA aatcc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM33 Overlap: 5
Solution location in genomic coordinates: 2054743-2054762
Solution sequence with flanking nucleotides: taaaa TTAAATATAAGATTATGGCT ttaga
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page