b2016 Gene Page
Genbank name: b2016
EcoGene name: yeeZ
Divergent gene:
Species with an ortholog:
AA EC SP ST YP
EcoGene link: EG13393
Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 11.32
Model logo: b2016.1.model.LGO.gif
Sequence logo: b2016.1.LGO.gif
Sequence Alignment: b2016.1.ALGN
Solution location in genomic coordinates: 2087209-2087225 R
Solution sequence with flanking nucleotides: agatt CATTCATAGAATGAATT gtcag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC SP YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 10.16
Model logo: b2016.2.model.LGO.gif
Sequence logo: b2016.2.LGO.gif
Sequence Alignment: b2016.2.ALGN
Solution location in genomic coordinates: 2087228-2087248 R
Solution sequence with flanking nucleotides: gcatg TCGTTATCATTATTGAACAGA ttcat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 9.95
Model logo: b2016.3.model.LGO.gif
Sequence logo: b2016.3.LGO.gif
Sequence Alignment: b2016.3.ALGN
Solution location in genomic coordinates: 2087412-2087435 R
Solution sequence with flanking nucleotides: gcagg AAACAGATAAGCGAATTGTTAAAA agatc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2087218-2087241 R
Solution sequence with flanking nucleotides: gttat CATTATTGAACAGATTCATTCATA gaatg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page