b2070 Gene Page
Genbank name: b2070
EcoGene name: yegI
Divergent gene: yegJ
Species with an ortholog:
EC TF
EcoGene link: EG14052
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 1.57
Model logo: b2070.1.model.LGO.gif
Sequence logo:
Sequence Alignment: b2070.1.ALGN
Solution location in genomic coordinates: 2149114-2149131 R
Solution sequence with flanking nucleotides: attga ATTGTATCCTGATAAAAT tgcat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yegI_yegJ_IR     Overlap: 15
Species that contributed to the solution: EC TF
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -0.69
Model logo: b2070.2.model.LGO.gif
Sequence logo: b2070.2.LGO.gif
Sequence Alignment: b2070.2.ALGN
Solution location in genomic coordinates: 2149167-2149188 R
Solution sequence with flanking nucleotides: tccct TTGTAGTCAAAGTTAGCAAAAA cctgt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page