b2073 Gene Page
Genbank name: b2073
EcoGene name: yegL
Divergent gene: yegM
Species with an ortholog:
EC TF
EcoGene link: EG14055
Species that contributed to the solution: EC TF
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 0.73
Model logo: b2073.1.model.LGO.gif
Sequence logo: b2073.1.LGO.gif
Sequence Alignment: b2073.1.ALGN
Solution location in genomic coordinates: 2151458-2151481 R
Solution sequence with flanking nucleotides: acgct GAAACGGGAAAGCCTCTCCCGGAG aagag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: QUAD1a     Overlap: 24
Solution location in genomic coordinates: 2151337-2151360 R
Solution sequence with flanking nucleotides: ccagg GGGAGGGGGAAACCTCTCCCTAAC cctca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: QUAD1a     Overlap: 24
Species that contributed to the solution: EC TF
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.58
Model logo: b2073.2.model.LGO.gif
Sequence logo: b2073.2.LGO.gif
Sequence Alignment: b2073.2.ALGN
Solution location in genomic coordinates: 2151608-2151631 R
Solution sequence with flanking nucleotides: gtcaa TCCGCAGGCTTTGTAGTCTGCGAT cctgc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page