b2074 Gene Page
Genbank name: b2074
EcoGene name: yegM
Divergent gene: yegL
Species with an ortholog:
EC ST
EcoGene link: EG14056
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 32.83
Model logo: b2074.1.model.LGO.gif
Sequence logo: b2074.1.LGO.gif
Sequence Alignment: b2074.1.ALGN
Solution location in genomic coordinates: 2151478-2151496
Solution sequence with flanking nucleotides: tcccg TTTCAGCGTCCCGCTGAAA tcatc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: QUAD1a     Overlap: 17
Solution location in genomic coordinates: 2151806-2151824
Solution sequence with flanking nucleotides: tcccg TTTCAGCGTCCCGCTGAAA tcgtc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: QUAD1b     Overlap: 17
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 30.66
Model logo: b2074.2.model.LGO.gif
Sequence logo: b2074.2.LGO.gif
Sequence Alignment: b2074.2.ALGN
Solution location in genomic coordinates: 2151461-2151477
Solution sequence with flanking nucleotides: ttctc CGGGAGAGGCTTTCCCG tttca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: QUAD1a     Overlap: 17
Solution location in genomic coordinates: 2151789-2151805
Solution sequence with flanking nucleotides: ttcct CGGGAGGGGCTTTCCCG tttca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: QUAD1b     Overlap: 17
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 29.84
Model logo: b2074.3.model.LGO.gif
Sequence logo: b2074.3.LGO.gif
Sequence Alignment: b2074.3.ALGN
Solution location in genomic coordinates: 2151411-2151430
Solution sequence with flanking nucleotides: ccagt ATGATGACGTGCTTCATCAT aaccc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: QUAD1a     Overlap: 20
Repeat: yegL_yegM_IR     Overlap: 20
Solution location in genomic coordinates: 2151740-2151759
Solution sequence with flanking nucleotides: ccacg ATGATGAGTAGCTTCATCAT gaccc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: QUAD1b     Overlap: 20
Gene Index Page