b2080 Gene Page

Genbank name: b2080
EcoGene name: yegP
Divergent gene:
Species with an ortholog: AA   EC   PA   SP   YP   
EcoGene link: EG14059
Species that contributed to the solution: AA EC PA
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 2.40
Model logo: b2080.1.model.LGO.gif
Sequence logo: b2080.1.LGO.gif
Sequence Alignment: b2080.1.ALGN
Solution location in genomic coordinates: 2163052-2163072
Solution sequence with flanking nucleotides: gagat GGCGTTCAGACCAGATCCGGC aacat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP149a     Overlap: 21
Species that contributed to the solution: AA EC PA SP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 2.31
Model logo: b2080.2.model.LGO.gif
Sequence logo: b2080.2.LGO.gif
Sequence Alignment: b2080.2.ALGN
Solution location in genomic coordinates: 2163026-2163049
Solution sequence with flanking nucleotides: tttta GCGACATTATTTTGTTAGCCGGAG atggc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP149a     Overlap: 11
Solution location in genomic coordinates: 2163142-2163165
Solution sequence with flanking nucleotides: tcgct CATACTTTAATCGGTAAACAGCAC cttta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP149b_yegP_IR     Overlap: 11
Species that contributed to the solution: AA EC PA SP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 1.81
Model logo: b2080.3.model.LGO.gif
Sequence logo: b2080.3.LGO.gif
Sequence Alignment: b2080.3.ALGN
Solution location in genomic coordinates: 2163038-2163059
Solution sequence with flanking nucleotides: tattt TGTTAGCCGGAGATGGCGTTCA gacca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP149a     Overlap: 21
Solution location in genomic coordinates: 2163076-2163097
Solution sequence with flanking nucleotides: gcaac ATTATCCCACGCATGGTCAGCA aactg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP149b     Overlap: 15


Gene Index Page