b2086 Gene Page

Repeat: yegR_yegS_IR1     Overlap: 11

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 3.85
Model logo: b2086.2.model.LGO.gif
Sequence logo: b2086.2.LGO.gif
Sequence Alignment: b2086.2.ALGN
Solution location in genomic coordinates: 2166417-2166436
Solution sequence with flanking nucleotides: ataat AAATGTTCTGTACAACATTT cctac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yegR_yegS_IR1     Overlap: 2
Repeat: yegR_yegS_IR2     Overlap: 2
Solution location in genomic coordinates: 2166696-2166715
Solution sequence with flanking nucleotides: gctct ACACTATCTACAGACCAATC ataaa
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 1.73
Model logo: b2086.3.model.LGO.gif
Sequence logo: b2086.3.LGO.gif
Sequence Alignment: b2086.3.ALGN
Solution location in genomic coordinates: 2166440-2166462
Solution sequence with flanking nucleotides: ttcct ACATAAGTAGGAATTACGGACAT tgagg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yegR_yegS_IR2     Overlap: 13


Gene Index Page