b2249 Gene Page
Genbank name: b2249
EcoGene name: yfaY
Divergent gene:
Species with an ortholog:
EC SP ST VC YP
EcoGene link: EG14087
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 7.77
Model logo: b2249.1.model.LGO.gif
Sequence logo: b2249.1.LGO.gif
Sequence Alignment: b2249.1.ALGN
Solution location in genomic coordinates: 2361666-2361688 R
Solution sequence with flanking nucleotides: ttgcg TTATAGTGATTCGATAACAAAAG cagga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 6.67
Model logo: b2249.2.model.LGO.gif
Sequence logo: b2249.2.LGO.gif
Sequence Alignment: b2249.2.ALGN
Solution location in genomic coordinates: 2361733-2361750 R
Solution sequence with flanking nucleotides: tgatc CCTTCCGGCGCGGCATTC tgtcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2361698-2361715 R
Solution sequence with flanking nucleotides: cagtt TCTTACTACGCCTTATCT ccctt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page