b2253 Gene Page

Repeat: ais_yfbE_IR     Overlap: 10

---

Species that contributed to the solution: EC SP ST TF VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 10.23
Model logo: b2253.2.model.LGO.gif
Sequence logo: b2253.2.LGO.gif
Sequence Alignment: b2253.2.ALGN
Solution location in genomic coordinates: 2363675-2363697
Solution sequence with flanking nucleotides: agaca ATTACCGTGAAATTGAGCTACAT ttctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2363833-2363855
Solution sequence with flanking nucleotides: agttt CTTAAGGTTAAGTTAATATTCTA tcctt
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 7.17
Model logo: b2253.3.model.LGO.gif
Sequence logo: b2253.3.LGO.gif
Sequence Alignment: b2253.3.ALGN
Solution location in genomic coordinates: 2363717-2363739
Solution sequence with flanking nucleotides: cgcag TTGGTGTAATATTAAAAATCCTA cgatg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page