b2290 Gene Page

Genbank name: b2290
EcoGene name: yfbQ
Divergent gene: lrhA
Species with an ortholog: EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG14101

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 19.89
Model logo: b2290.1.model.LGO.gif
Sequence logo: b2290.1.LGO.gif
Sequence Alignment: b2290.1.ALGN
Solution location in genomic coordinates: 2405149-2405166
Solution sequence with flanking nucleotides: aaacc TTTTTGAATATTAAATAA taatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2405432-2405449
Solution sequence with flanking nucleotides: tgtca TTATTAAGTTATTAACAG cacaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 19.75
Model logo: b2290.2.model.LGO.gif
Sequence logo: b2290.2.LGO.gif
Sequence Alignment: b2290.2.ALGN
Solution location in genomic coordinates: 2405500-2405517
Solution sequence with flanking nucleotides: tcaaa ACACCGTCCTGGGGGAGT acatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2405534-2405551
Solution sequence with flanking nucleotides: agctg ACTTCCACGGCAGGGAGT ggcga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 16.33
Model logo: b2290.3.model.LGO.gif
Sequence logo: b2290.3.LGO.gif
Sequence Alignment: b2290.3.ALGN
Solution location in genomic coordinates: 2405156-2405177
Solution sequence with flanking nucleotides: tttga ATATTAAATAATAATTAATTAG catca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2405469-2405490
Solution sequence with flanking nucleotides: cccct CTGGCAAAATCTTATTCTGCAG acctt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page