b2290 Gene Page

Solution location in genomic coordinates: 2405432-2405449
Solution sequence with flanking nucleotides: tgtca TTATTAAGTTATTAACAG cacaa
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 19.75
Model logo: b2290.2.model.LGO.gif
Sequence logo: b2290.2.LGO.gif
Sequence Alignment: b2290.2.ALGN
Solution location in genomic coordinates: 2405500-2405517
Solution sequence with flanking nucleotides: tcaaa ACACCGTCCTGGGGGAGT acatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2405534-2405551
Solution sequence with flanking nucleotides: agctg ACTTCCACGGCAGGGAGT ggcga
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 16.33
Model logo: b2290.3.model.LGO.gif
Sequence logo: b2290.3.LGO.gif
Sequence Alignment: b2290.3.ALGN
Solution location in genomic coordinates: 2405156-2405177
Solution sequence with flanking nucleotides: tttga ATATTAAATAATAATTAATTAG catca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2405469-2405490
Solution sequence with flanking nucleotides: cccct CTGGCAAAATCTTATTCTGCAG acctt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page