b2291 Gene Page

Genbank name: b2291
EcoGene name: yfbR
Divergent gene:
Species with an ortholog: AA EC SP ST VC YP
EcoGene link: EG14102

Species that contributed to the solution: AA EC SP VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 6.37
Model logo: b2291.1.model.LGO.gif
Sequence logo: b2291.1.LGO.gif
Sequence Alignment: b2291.1.ALGN
Solution location in genomic coordinates: 2406848-2406869
Solution sequence with flanking nucleotides: ccaca ATGACCTGATGATGTCATCATA cgtaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.74
Model logo: b2291.2.model.LGO.gif
Sequence logo: b2291.2.LGO.gif
Sequence Alignment: b2291.2.ALGN
Solution location in genomic coordinates: 2406801-2406824
Solution sequence with flanking nucleotides: taatc TTAATTTCACTGCCGGAGATTGCA tccgg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt167 Overlap: 13

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 5.32
Model logo: b2291.3.model.LGO.gif
Sequence logo: b2291.3.LGO.gif
Sequence Alignment: b2291.3.ALGN
Solution location in genomic coordinates: 2406828-2406847
Solution sequence with flanking nucleotides: catcc GGCAGCGTTATCCCGCCACA atgac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt167 Overlap: 3

Gene Index Page