b2294 Gene Page

Genbank name: b2294
EcoGene name: yfbU
Divergent gene:
Species with an ortholog: EC   ST   VC   YP   
EcoGene link: EG14105

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.28
Model logo: b2294.1.model.LGO.gif
Sequence logo: b2294.1.LGO.gif
Sequence Alignment: b2294.1.ALGN
Solution location in genomic coordinates: 2410674-2410696 R
Solution sequence with flanking nucleotides: taa TTGACCCCTGATTACGCATATAA aagaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfbU_yfbV_IR     Overlap: 6

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.76
Model logo: b2294.2.model.LGO.gif
Sequence logo: b2294.2.LGO.gif
Sequence Alignment: b2294.2.ALGN
Solution location in genomic coordinates: 2410650-2410673 R
Solution sequence with flanking nucleotides: tataa AAGAAGGCATACTCAGCCTTCTTT ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfbU_yfbV_IR     Overlap: 24

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.35
Model logo: b2294.3.model.LGO.gif
Sequence logo: b2294.3.LGO.gif
Sequence Alignment: b2294.3.ALGN
Solution location in genomic coordinates: 2410633-2410649 R
Solution sequence with flanking nucleotides: tcttt TTTTTCACCGTAGTAGA
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfbU_yfbV_IR     Overlap: 5


Gene Index Page