b2295 Gene Page

Solution location in genomic coordinates: 2411174-2411192 R
Solution sequence with flanking nucleotides: tttgc ACAAATTTTTGAATCTTTA tatgt
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 25.43
Model logo: b2295.2.model.LGO.gif
Sequence logo: b2295.2.LGO.gif
Sequence Alignment: b2295.2.ALGN
Solution location in genomic coordinates: 2411457-2411480 R
Solution sequence with flanking nucleotides: gtacc TATAATTGATACGTGGCTAAAAAA acgtc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2411363-2411386 R
Solution sequence with flanking nucleotides: caaat TTTTTTTGCATGATGGAAGAAATA tcttg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfbV_ackA_IR     Overlap: 24

---

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 22.71
Model logo: b2295.3.model.LGO.gif
Sequence logo: b2295.3.LGO.gif
Sequence Alignment: b2295.3.ALGN
Solution location in genomic coordinates: 2411399-2411419 R
Solution sequence with flanking nucleotides: gacac CGACATTTATGATTAACATCA tgcac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfbV_ackA_IR     Overlap: 21


Gene Index Page