b2322 Gene Page

Genbank name: b2322
EcoGene name: yfcJ
Divergent gene:
Species with an ortholog: EC PA ST
EcoGene link: EG14113

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.58
Model logo: b2322.1.model.LGO.gif
Sequence logo: b2322.1.LGO.gif
Sequence Alignment: b2322.1.ALGN
Solution location in genomic coordinates: 2438141-2438157 R
Solution sequence with flanking nucleotides: gcgct GCATTCTGGAGTAATGC
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.61
Model logo: b2322.2.model.LGO.gif
Sequence logo: b2322.2.LGO.gif
Sequence Alignment: b2322.2.ALGN
Solution location in genomic coordinates: 2438225-2438240 R
Solution sequence with flanking nucleotides: tctga AAAGACGTACGCGTTA aatcc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.55
Model logo: b2322.3.model.LGO.gif
Sequence logo: b2322.3.LGO.gif
Sequence Alignment: b2322.3.ALGN
Solution location in genomic coordinates: 2438164-2438184 R
Solution sequence with flanking nucleotides: agatg AGACGGGGATACTCCTCGCCT tgcgc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page