b2331 Gene Page

Solution location in genomic coordinates: 2446365-2446386
Solution sequence with flanking nucleotides: tacca GATATTTGCCGCGCTGAAGCGG ctcac
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 15.39
Model logo: b2331.2.model.LGO.gif
Sequence logo: b2331.2.LGO.gif
Sequence Alignment: b2331.2.ALGN
Solution location in genomic coordinates: 2446139-2446161
Solution sequence with flanking nucleotides: gcgtt CATCGACGTAAAATTCATGGCCG cagaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2446439-2446461
Solution sequence with flanking nucleotides: tgctt CATCAACGAAAATTTTATCCACG tattc
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 11.51
Model logo: b2331.3.model.LGO.gif
Sequence logo: b2331.3.LGO.gif
Sequence Alignment: b2331.3.ALGN
Solution location in genomic coordinates: 2446161-2446182
Solution sequence with flanking nucleotides: tggcc GCAGAACCACGCTTTGTTGGTC aggta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2446226-2446247
Solution sequence with flanking nucleotides: cacgc GTTCAACAATACGGTGTTTTTC gctgg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page