b2340 Gene Page

Genbank name: b2340
EcoGene name: sixA
Divergent gene:
Species with an ortholog: AA EC HI SP ST VC YP
EcoGene link: EG14126

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 18.78
Model logo: b2340.1.model.LGO.gif
Sequence logo: b2340.1.LGO.gif
Sequence Alignment: b2340.1.ALGN
Solution location in genomic coordinates: 2454936-2454958 R
Solution sequence with flanking nucleotides: actta CGCCATTGAGGTAAAAAACAGCG tttca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 13
Number of E. coli sites in the solution: 2
Map value: 17.32
Model logo: b2340.2.model.LGO.gif
Sequence logo: b2340.2.LGO.gif
Sequence Alignment: b2340.2.ALGN
Solution location in genomic coordinates: 2454907-2454930 R
Solution sequence with flanking nucleotides: tttca TTCGGTGAATGGATAAGGCACAAT gccgg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2454833-2454856 R
Solution sequence with flanking nucleotides: gcgaa TCTGGTTAACAAAAGCGGTGCAAT
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 14.21
Model logo: b2340.3.model.LGO.gif
Sequence logo: b2340.3.LGO.gif
Sequence Alignment: b2340.3.ALGN
Solution location in genomic coordinates: 2454937-2454956 R
Solution sequence with flanking nucleotides: ttacg CCATTGAGGTAAAAAACAGC gtttc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2454840-2454859 R
Solution sequence with flanking nucleotides: cgggc GAATCTGGTTAACAAAAGCG gtgca
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page