b2342 Gene Page

Genbank name: b2342
EcoGene name: yfcY
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST VC YP
EcoGene link: EG14128

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 27.97
Model logo: b2342.1.model.LGO.gif
Sequence logo: b2342.1.LGO.gif
Sequence Alignment: b2342.1.ALGN
Solution location in genomic coordinates: 2458516-2458532 R
Solution sequence with flanking nucleotides: ctatg ATCAGGTCAGACCACTT tattt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 22.56
Model logo: b2342.2.model.LGO.gif
Sequence logo: b2342.2.LGO.gif
Sequence Alignment: b2342.2.ALGN
Solution location in genomic coordinates: 2458536-2458558 R
Solution sequence with flanking nucleotides: ggcta AATGTAAAAAAATGGTTAAGACT atgat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 4.82
Model logo: b2342.3.model.LGO.gif
Sequence logo: b2342.3.LGO.gif
Sequence Alignment: b2342.3.ALGN
Solution location in genomic coordinates: 2458632-2458655 R
Solution sequence with flanking nucleotides: ggtac GTACGCCCCTGTCAGTTGCTGGCA ggggc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfcY_yfcZ_IR Overlap: 22

Gene Index Page