b2343 Gene Page
Genbank name: b2343
EcoGene name: yfcZ
Divergent gene: fadL
Species with an ortholog:
AA EC ST YP
EcoGene link: EG14129
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 18.62
Model logo: b2343.1.model.LGO.gif
Sequence logo: b2343.1.LGO.gif
Sequence Alignment: b2343.1.ALGN
Solution location in genomic coordinates: 2459273-2459289 R
Solution sequence with flanking nucleotides: aacta TGTTACGTGCTGTAACA ggagc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 17.41
Model logo: b2343.2.model.LGO.gif
Sequence logo: b2343.2.LGO.gif
Sequence Alignment: b2343.2.ALGN
Solution location in genomic coordinates: 2459151-2459173 R
Solution sequence with flanking nucleotides: tatct TTTTTCAAATATGATCTAAGAAA cgcga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2459062-2459084 R
Solution sequence with flanking nucleotides: agatc ATTTTTAAGTGTGATTTCGGTCA cttat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 14.76
Model logo: b2343.3.model.LGO.gif
Sequence logo: b2343.3.LGO.gif
Sequence Alignment: b2343.3.ALGN
Solution location in genomic coordinates: 2459228-2459249 R
Solution sequence with flanking nucleotides: tctga GGTACATCTTAGAAATCAGACC agtgg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2459204-2459225 R
Solution sequence with flanking nucleotides: accag TGGCGAGAGTATAGGTCGGACC agctg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page