b2350 Gene Page
Genbank name: b2350
EcoGene name: yfdG
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG14131
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.94
Model logo: b2350.1.model.LGO.gif
Sequence logo: b2350.1.LGO.gif
Sequence Alignment: b2350.1.ALGN
Solution location in genomic coordinates: 2465818-2465838
Solution sequence with flanking nucleotides: tatcg ATCGATTAAGACTTGGATGAT agact
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.23
Model logo: b2350.2.model.LGO.gif
Sequence logo: b2350.2.LGO.gif
Sequence Alignment: b2350.2.ALGN
Solution location in genomic coordinates: 2465851-2465874
Solution sequence with flanking nucleotides: attcc TTTGATTATTAGCTGATAGAAGAA
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.67
Model logo: b2350.3.model.LGO.gif
Sequence logo: b2350.3.LGO.gif
Sequence Alignment: b2350.3.ALGN
Solution location in genomic coordinates: 2465753-2465774
Solution sequence with flanking nucleotides: acaaa GTCTTGCAATCCAGTGCAAAGC tttgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: intS_yfdG_IR Overlap: 22
Gene Index Page