b2373 Gene Page

Genbank name: b2373
EcoGene name: yfdU
Divergent gene:
Species with an ortholog: EC   PA   VC   YP   
EcoGene link: EG14143

Species that contributed to the solution: EC VC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 4.99
Model logo: b2373.1.model.LGO.gif
Sequence logo: b2373.1.LGO.gif
Sequence Alignment: b2373.1.ALGN
Solution location in genomic coordinates: 2489974-2489993 R
Solution sequence with flanking nucleotides: attta TAAAAATTTCGAGGTTATTA atc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 1.44
Model logo: b2373.2.model.LGO.gif
Sequence logo: b2373.2.LGO.gif
Sequence Alignment: b2373.2.ALGN
Solution location in genomic coordinates: 2489998-2490020 R
Solution sequence with flanking nucleotides: gatat TAACGGGGGCTTCTGGCTCCCAA tttat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page