b2379 Gene Page

Genbank name: b2379
EcoGene name: yfdZ
Divergent gene: ypdA
Species with an ortholog: EC PA ST TF YP
EcoGene link: EG14198

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 32.33
Model logo: b2379.1.model.LGO.gif
Sequence logo: b2379.1.LGO.gif
Sequence Alignment: b2379.1.ALGN
Solution location in genomic coordinates: 2496338-2496356 R
Solution sequence with flanking nucleotides: agcgt CGCTCGGACGGTCCGGGCG ctaac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST TF
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 13.62
Model logo: b2379.2.model.LGO.gif
Sequence logo: b2379.2.LGO.gif
Sequence Alignment: b2379.2.ALGN
Solution location in genomic coordinates: 2496358-2496376 R
Solution sequence with flanking nucleotides: aaaac AGCCACCATCGTGGCAGCG tcgct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 12.29
Model logo: b2379.3.model.LGO.gif
Sequence logo: b2379.3.LGO.gif
Sequence Alignment: b2379.3.ALGN
Solution location in genomic coordinates: 2496619-2496641 R
Solution sequence with flanking nucleotides: aaggc TGATGACCAGCAGGCCGTTTTTG aggaa
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page