b2380 Gene Page

Genbank name: b2380
EcoGene name: ypdA
Divergent gene: yfdZ
Species with an ortholog: EC   SP   VC   YP   
EcoGene link: EG14148

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.65
Model logo: b2380.1.model.LGO.gif
Sequence logo: b2380.1.LGO.gif
Sequence Alignment: b2380.1.ALGN
Solution location in genomic coordinates: 2496607-2496628
Solution sequence with flanking nucleotides: aaatt GTGGTTTTTCCTCAAAAACGGC ctgct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 5.55
Model logo: b2380.2.model.LGO.gif
Sequence logo: b2380.2.LGO.gif
Sequence Alignment: b2380.2.ALGN
Solution location in genomic coordinates: 2496440-2496463
Solution sequence with flanking nucleotides: tgacg TTAAATGAGGAACTCTGCTTTAAA aacag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2496598-2496621
Solution sequence with flanking nucleotides: cccct TTTAAAATTGTGGTTTTTCCTCAA aaacg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 5.07
Model logo: b2380.3.model.LGO.gif
Sequence logo: b2380.3.LGO.gif
Sequence Alignment: b2380.3.ALGN
Solution location in genomic coordinates: 2496379-2496398
Solution sequence with flanking nucleotides: gctgt TTTGAAAATAGCCTGATTAA tttct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2496584-2496603
Solution sequence with flanking nucleotides: attta TCTATCAATCCCCTTTTAAA attgt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page