b2392 Gene Page

Genbank name: b2392
EcoGene name: mntA
Divergent gene: nupC
Species with an ortholog: EC   PA   ST   YP   
EcoGene link: EG14157

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 19.24
Model logo: b2392.1.model.LGO.gif
Sequence logo: b2392.1.LGO.gif
Sequence Alignment: b2392.1.ALGN
Solution location in genomic coordinates: 2510774-2510790 R
Solution sequence with flanking nucleotides: tgaat TTGATAATCATTCTCGT ttggc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 17.75
Model logo: b2392.2.model.LGO.gif
Sequence logo: b2392.2.LGO.gif
Sequence Alignment: b2392.2.ALGN
Solution location in genomic coordinates: 2511041-2511058 R
Solution sequence with flanking nucleotides: att TGCTCCAAATATGAGGCA ggtta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 16.04
Model logo: b2392.3.model.LGO.gif
Sequence logo: b2392.3.LGO.gif
Sequence Alignment: b2392.3.ALGN
Solution location in genomic coordinates: 2511040-2511060 R
Solution sequence with flanking nucleotides: a TTTGCTCCAAATATGAGGCAG gttaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2511012-2511032 R
Solution sequence with flanking nucleotides: taaat TTCCGTGCACATTCTATGTAA catgg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page