b2431 Gene Page
Genbank name: b2431
EcoGene name: yfeX
Divergent gene:
Species with an ortholog:
EC PA SP ST VC YP
EcoGene link: EG14165
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 17.71
Model logo: b2431.1.model.LGO.gif
Sequence logo: b2431.1.LGO.gif
Sequence Alignment: b2431.1.ALGN
Solution location in genomic coordinates: 2548603-2548624 R
Solution sequence with flanking nucleotides: aacac GTAAAATAGCGCTCAACAATGC cacgg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfeX_yfeY_IR     Overlap: 8
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 17.38
Model logo: b2431.2.model.LGO.gif
Sequence logo: b2431.2.LGO.gif
Sequence Alignment: b2431.2.ALGN
Solution location in genomic coordinates: 2548643-2548662 R
Solution sequence with flanking nucleotides: t AATTTGCGTCTGAACAAACC gccgc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page