b2432 Gene Page
Genbank name: b2432
EcoGene name: yfeY
Divergent gene:
Species with an ortholog:
EC ST YP
EcoGene link: EG14166
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.53
Model logo: b2432.1.model.LGO.gif
Sequence logo: b2432.1.LGO.gif
Sequence Alignment: b2432.1.ALGN
Solution location in genomic coordinates: 2549268-2549287 R
Solution sequence with flanking nucleotides: acttt TTGGTGAATTTGCACTCCAA gcaac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.09
Model logo: b2432.2.model.LGO.gif
Sequence logo: b2432.2.LGO.gif
Sequence Alignment: b2432.2.ALGN
Solution location in genomic coordinates: 2549247-2549264 R
Solution sequence with flanking nucleotides: aagca ACGTTATTGAATAACCAA aggaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page