b2463 Gene Page
Genbank name: b2463
EcoGene name: maeB
Divergent gene: talA
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG14193
Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 27.82
Model logo: b2463.1.model.LGO.gif
Sequence logo: b2463.1.LGO.gif
Sequence Alignment: b2463.1.ALGN
Solution location in genomic coordinates: 2576632-2576655 R
Solution sequence with flanking nucleotides: tgtta GATGAGTGCGTTAATTCACACTTC tgaga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: maeB_talA_IR     Overlap: 18
Solution location in genomic coordinates: 2576494-2576517 R
Solution sequence with flanking nucleotides: tggtg AGAGTTTGGACTTGCTCAAAGTCT gtaga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA ST TF VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 11.23
Model logo: b2463.2.model.LGO.gif
Sequence logo: b2463.2.LGO.gif
Sequence Alignment: b2463.2.ALGN
Solution location in genomic coordinates: 2576661-2576679 R
Solution sequence with flanking nucleotides: ggaaa TACTCCTTGAAAAGTAAAG tgtta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2576402-2576420 R
Solution sequence with flanking nucleotides: gtgaa CGTTACGTGAAAGGAACAA ccaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI PA SP ST TF VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 9.78
Model logo: b2463.3.model.LGO.gif
Sequence logo: b2463.3.LGO.gif
Sequence Alignment: b2463.3.ALGN
Solution location in genomic coordinates: 2576662-2576678 R
Solution sequence with flanking nucleotides: gaaat ACTCCTTGAAAAGTAAA gtgtt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2576467-2576483 R
Solution sequence with flanking nucleotides: ctccg GCAGGGTAATAATGTGC gccac
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page