b2475 Gene Page

Genbank name: b2475
EcoGene name: ypfJ
Divergent gene:
Species with an ortholog: EC PA SP ST YP
EcoGene link: EG14197

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.12
Model logo: b2475.1.model.LGO.gif
Sequence logo: b2475.1.LGO.gif
Sequence Alignment: b2475.1.ALGN
Solution location in genomic coordinates: 2594773-2594792 R
Solution sequence with flanking nucleotides: ctacg ATCATTTCTATAATGAATAT attgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.49
Model logo: b2475.2.model.LGO.gif
Sequence logo: b2475.2.LGO.gif
Sequence Alignment: b2475.2.ALGN
Solution location in genomic coordinates: 2594812-2594828 R
Solution sequence with flanking nucleotides: atccc GCTTTCCTGTGGTAATC ttcct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 6.18
Model logo: b2475.3.model.LGO.gif
Sequence logo: b2475.3.LGO.gif
Sequence Alignment: b2475.3.ALGN
Solution location in genomic coordinates: 2594874-2594893 R
Solution sequence with flanking nucleotides: agctg GCACGGCAAGACAACCGCTC tcgga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ypfJ_purC_IR Overlap: 11

Gene Index Page